Early discovery breakthroughs in therapeutic development begin with research single guide RNA (sgRNA).
We made it easy to order sgRNA with our user-friendly order interface.
*For gRNA lengths >115 nucleotides, HPLC purification, and/or larger yield options, schedule a call with our sales team and select 'Synthetic sgRNA' as your ‘Product of Interest’ on the form. Our team is excited to discuss how we can support your projects.
Compatible With Your Nuclease: For CRISPR experiments using novel, engineered, or well-established nucleases, our Research sgRNA are best-in-class enabling you to maximize your nucleases' efficiency for early therapeutic development and discovery research.
Assess More Modifications For Precision: Our standard modifications, which include 2'-O-methyl (OMe) analogs and 3' phosphorothioate (PS) linkages, enhance gRNA stability and performance. For nuclease testing requiring custom placement of the OMe analog and PS linkages, our Research sgRNA allows you to precisely select their locations to optimize your gRNA for your experiments.
Explore Alternative Modifications: CRISPR experimentation is diverse, and OMe analogs and PS bonds are just the beginning. If your CRISPR experiments require alternative sgRNA chemical modifications beyond OMe analogs and PS bonds, our Research sgRNA are fully customizable to support your unique research goals.
| Gene Name | hfCas12Max Target Sequence |
|---|---|
| B2M | TATCTCTTGTACTACACTGA |
| TRAC | GAGTCTCTCAGCTGGTACAC |
*Validated in human cell lines (HEK293T, T Cells, and iPSC). hfCas12Max gRNAs are not compatible with eSpOT-ON or SpCas9. SpCas9 sgRNA controls can be purchased here. eSpOT-ON and AccuBase controls can be purchased through our sales team.
To design your own guide RNA, select your target sequences using your favorite CRISPR design platform, such as CHOPCHOP, Benchling, CRISPOR, or Cas-Designer CRISPR RGEN Tools. PAM sequences for eSpOT-ON, hfCas12Max, and SpCas9 are below:
To order your guide RNA, upload your target sequences without the PAM sequence into our easy-to-use ordering interface so we can synthesize your guide RNA.
| CRISPR gene editor | Synthego's standard chemical modification pattern |
|---|---|
|
eSpOT-ON recombinant protein eSpOT-ON mRNA |
2'-O-Methyl analog at the first 3 and last 3 bases and 3' phosphorothioate bonds between 3 first and last 4 bases |
| hfCas12Max recombinant protein | 2'-O-Methyl analog at the first 3 bases. The last 4 bases have 3 modifications ending with a nonmodified base. With 3' phosphorothioate bonds between 3 first and last 4 bases. |
| AccuBase cytosine base editor protein | 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases |
| SpCas9 recombinant protein | 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases |
Complexing hfCas12Max nuclease with our best-in-class Research sgRNA achieves consistently high editing efficiencies. If you are seeking alternatives CRISPR gene editing methods, hfCas12Max is the nuclease you need for your next CRISPR experiment or therapeutic development.
Learn More about our high-fidelity Cas12 nuclease, hfCas12Max, as it sets the stage for being the next alternative nuclease used to develop life-saving cell and gene therapies using CRISPR.
SpCas9 nuclease is widely used to perform CRISPR experiments. When complexed with our best-in-class Research sgRNA, SpCas9 achieves editing efficiencies that are unattainable with other sgRNA options. High-efficiency CRISPR T cell editing can be achieved to develop CAR-T cell therapies and fight viral infections.
Not all cell types are easy to perform CRISPR experiments in. Certain cell types, like human resting T cells, can be challenging to achieve high editing efficiencies while maintaining high cell viability. Our best-in-class Research sgRNA and SpCas9 nuclease can overcome these challenges in even the most difficult cell types.
eSpOT-ON Nuclease (protein or mRNA) |
SpCas9 Nuclease |
hfCas12Max Nuclease |
|
|---|---|---|---|
| Description | Engineered from PsCas9 to achieve high on-target editing and minimized off-target editing | The nuclease that led to Jennifer Doudna and Emmanuelle Charpentier's Nobel Prize. | Engineered from Cas12i to achieve higher on-target editing and minimized off-target editing. |
| Size | 1409 amino acids | 1368 amino acids | 1080 amino acids |
| PAM Sequence (N = any nucleotide) | 5'-NGG-3'PAM PAM 3' of the target DNA sequence |
5'-NGG-3’ PAM is 3’ of the target DNA sequence |
5'-TN-3' or 5'-TTN-3' |
| DNA Cleavage | Staggered-cut cleavage on the target strand occurs 3nt upstream of the PAM, while the non-target strand is cut 6-7nt upstream of the PAM. |
Blunt end cut Cleavage 3nt upstream of PAM sequence |
Staggered-cut Cleavage on the target strand occurs 24nt downstream from PAM, while the non-targeted strand is cut 14-16nt downstream. |
| Endonuclease Domains | HNH and RuvC | HNH and RuvC | RuvC |
| gRNA Length and Target Sequence | 109nt 22nt target sequence |
97 - 103nt 20nt Target Sequence |
44 - 50nt 20nt Target Sequence |
| gRNA Components | crRNA + tracrRNA as a single guide RNA (sgRNA) | crRNA + tracrRNA as a single guide RNA (sgRNA) | crRNA |
| Variants or Origin | Engineered from Parasutterella secunda (PsCas9) | Type IIa CRISPR-Cas system of Streptococcus pyogenes Cas9 |
Type V CRISPR-Cas system of Cas12 |
Our continuum of CRISPR solutions enables therapeutic developers to transition seamlessly from early discovery breakthroughs to clinical trials - research to GMP. With over +1 million sgRNA synthesized and used across various applications, researchers know the benefits of our best-in-class sgRNA because they provide them the flexibility in scale, length, and purity to suit their specific needs.
Within our continuum of CRISPR solutions, our Research sgRNA are sought out by scientists to start their therapeutic development because they can achieve editing efficiencies up to 99% and can easily scale during the development phase of their work. Synthesized for early discovery and research applications, breakthroughs in therapeutics and science begin with our best-in-class Research sgRNA.
When transitioning from discovery research to preclinical studies and clinical applications, it’s crucial to use high-quality sgRNA from a trusted manufacturer with a proven track record in synthesizing GMP-grade sgRNA that meets current good manufacturing practice standards. However, not all GMP materials adhere to these standards. Synthego has been producing GMP sgRNA that meets regulatory requirements for years, helping scientists seamlessly transition their therapeutic development through each phase toward clinical application. If you're preparing to move your therapeutic into preclinical studies or clinical trials, contact us to learn how we can support your journey.
Not all chemically synthesized sgRNA are manufactured equally. During synthesis, some oligomers fail to extend during each cycle resulting in undesired truncated molecules mixed in with your desired sgRNA. Additionally, several types of chemical contaminants can be introduced through the manufacturing process of sgRNA. The presence of both these impurities can increase off-target binding, reduce on-target binding, or both. Several vendors offer high-performance liquid chromatography (HPLC) as a purification step to eliminate the unwanted truncated oligomers (n-3 to n-5) and contaminants. However, each vendor might have different synthesis and quality standards to reach the purity levels desired for your sgRNA.
Synthego’s best-in-class sgRNA can achieve exceptional editing efficiencies through standard manufacturing processes (non-HPLC) compared to HPLC purified sgRNA from other vendors. If the purity was substantially better, you would expect the HPLC purified sgRNA to perform better in all cases. However, that is not always the case in our study.
Depending on your application, particularly sensitive applications like therapeutic development require sgRNA that achieves high performance in early development and highly pure sgRNA as development progresses towards the clinic. To learn more about our sgRNA purity and which of Synthego’s best-in-class sgRNA is right for your application, contact our sales team here.
Synthego’s Research sgRNA are explicitly designed for research purposes only and should not be used for human application, including but not limited to clinical trials and diagnostics. If you are seeking higher purity sgRNA or require more in-depth Quality Control documentation not provided by our research sgRNA deliverables (see table below), contact our Sales Team for further information.
| Deliverables |
|
| gRNA Length | hfCas12Max (PAM sequence 5’-TN or 5’-(T)TNN)
Note: The PAM sequence is not included in the final guide RNA design. |
| Modification | hfCas12Max
|
| Yield Offerings | Tube (nmol): 1.5, 3, 5, 10, 20, 30, 50, 100 Tube (nmol): >100* Plate (nmol): 1.5, 3, 5, 10 |
| QC and Purification |
|
Cart
Account
Your Orders
Sign In