High-fidelity Cas12 nuclease protein for therapeutic gene editing
hfCas12Max is a high-fidelity CRISPR nuclease engineered for therapeutic genome editing. It offers high on-target and low off-target editing across various cell types. Its small size and broad PAM sequence recognition make it an ideal choice for both ex vivo and in vivo CRISPR-based therapeutic development, allowing you to edit more of the genome with confidence.
| Product Number | R20HFCAS12MAX |
| Concentration | 2.93 mg/mL 10 mg/mL |
| Volume | 15 µL 50 µL 100 µL 500 µL |
| Intended Use | This product is intended for research use only |
| Shipping Conditions | Cold Pack |
| Buffer Composition | 30mM Tris, 350mM NaCl, 50% Glycerol, 0.1mM EDTA, 1mM DTT, pH 8.0 |
| Source | E. coli |
| Purity | ≥ 95% |
| Delivery Format | Tubes |
| Function | Enables high-fidelity gene editing with an expanded targeting range through direct delivery of a ribonucleoprotein (RNP) complex. |
| For Use In | CRISPR gene editing experiments utilizing the hfCas12Max recombinant protein nuclease |
| Storage Temperature | -20 C |
Navigating the SpCas9 intellectual property landscape for cell and gene therapies can be complex and may lead to development delays. To overcome these challenges, researchers are turning to alternative nucleases with therapeutic potential. These alternative nucleases offer efficient editing across diverse cell populations and can effectively target specific genomic regions, supporting the advancement of innovative therapies. Enter hfCas12Max nuclease, an engineered Cas12i nuclease.
As a nuclease already in clinical trials treating Duchenne muscular dystrophy, hfCas12Max nuclease has demonstrated to be great for developing cell and gene therapies due to its high fidelity, broad PAM recognition profile, and small size. Across various cell types, including primary T cells and iPSCs, hfCas12Max nuclease consistently has high performance, resulting in high on-target and minimal off-target editing, referred to as high-fidelity. Due to its high-fidelity, hfCas12Max nuclease is also a safer nuclease candidate to use in therapies compared to nucleases that result in low on-target and high-off-target editing. To enable scientists to access a wider genomic region to target for the development of novel and innovative therapies, hfCas12Max nuclease broad PAM sequence recognition profile expands where gene editing can occur with continued high-fidelity. Lastly, delivering hfCas12Max nuclease in lipid nanoparticles (LNPs) or adeno-associated viruses (AAVs) for in vivo CRISPR-based therapies is easier because of its smaller size (1080 amino acids) compared to SpCas9 nuclease (1368 amino acids) and LbCas12a nuclease (1228 amino acids).
Are you looking to commercialize your ex vivo or in vivo therapeutic using hfCas12Max nuclease? With lower upfront costs and clear milestones, licensing hfCas12Max simplifies your path to commercialization. Contact our team today to learn how you can secure your hfCas12Max license and take the next step toward developing your therapy to help those who need it.
| Gene Name | hfCas12Max Target Sequence |
|---|---|
| B2M | TATCTCTTGTACTACACTGA |
| TRAC | GAGTCTCTCAGCTGGTACAC |
For CRISPR gene editing, hfCas12Max nuclease is unique in that it can complex with crRNA without the need for a tracrRNA. This means hfCas12Max gRNA length is small, ranging from 44-50 nucleotides (nt) in length, where the target genomic sequence is 17-23 nt long. When complexed with our best-in-class Research gRNA, hfCas12Max nuclease single RuVC domain will nick the non-target strand and cut the targeted strand in a staggered manner; cleavage predicted 14-16 nt and 24 nt downstream of the PAM site for non-targeted and targeted strand, respectively.
To design hfCas12Max gRNA, upload the 5'-TN-3' or 5'-TTN-3' PAM sequence into your favorite guide design platform (e.g., CHOPCHOP, Benchling, CRISPOR, or CRISPR RGEN Tools). Once your hfCas12Max gRNA is designed, we will synthesize them quickly so you can start using hfCas12Max in your work immediately. Currently, you can order hfCas12Max gRNA with modifications because the modifications enhance gene editing efficiency. The following modifications are included on our hfCas12Max modified gRNA:
2'-O-Methyl analog at the first 3 bases. The last 4 bases have 3 modifications ending with a nonmodified base. With 3' phosphorothioate bonds between 3 first and last 4 bases.
We strongly encourage you to follow our user guide to review important information before using hfCas12Max nuclease and gRNA. We also developed transfection protocols specifically designed for our gRNA and nucleases to help you get started with your experiments. Following any CRISPR experiment, it is best practice to analyze your CRISPR edits. One way you can analyze your hfCas12Max CRISPR edits is by using platforms like the Inference of CRISPR Edits analysis tool, or ICE for short.
SpCas9 Nuclease |
hfCas12Max Nuclease |
||
|---|---|---|---|
| Description | The nuclease that led to Jennifer Doudna and Emmanuelle Charpentier's Nobel Prize. | Engineered from Cas12i to achieve higher on-target editing and minimized off-target editing. | |
| Size | 1368 amino acids | 1080 amino acids | |
| PAM Sequence (N = any nucleotide) | 5'-NGG-3' PAM is 3’ of the target DNA sequence |
5'-TN-3' or 5'-TTN-3 | |
| DNA Cleavage | Blunt end cut 3nt upstream of PAM sequence. | Staggered-cut: cleavage on the target strand occurs 24nt downstream from PAM, while the non-targeted strand is cut 14-16nt downstream. | |
| Endonuclease Domains | HNH and RuvC | RuvC | |
| gRNA Length and Target Sequence | 97 - 103nt 20nt Target Sequence |
44 - 50nt 20nt Target Sequence |
|
| gRNA Components | crRNA + tracrRNA as a single guide RNA (sgRNA) | crRNA | |
| Variants or Origin | Streptococcus pyogenes (Wildtype) | Engineered from Cas12i | |
| CRISPR Enzyme Class | Type IIa CRISPR-Cas system of Streptococcus pyogenes Cas9 | Type V CRISPR-Cas system of Cas12 | |
| Application | A wide range of applications spanning from research use to cell & gene therapy development for clinical trials. |
As you develop your CRISPR-based therapeutic using hfCas12Max nuclease, you will need to navigate the regulatory landscape to successfully reach the clinic. Although a daunting task, our Regulatory Experts can help guide you through the regulatory process.
To learn about the regulatory process, download our Regulatory eBook — a comprehensive guide to navigating the regulatory framework for CRISPR clinical trials.
Check out the science behind how hfCas12Max nuclease was engineered for therapeutic application.
The publication highlights the development of hfCas12Max nuclease, an engineered high-fidelity variant of the Cas12i system, optimized for therapeutic application. Engineered using a unique platform, hfCas12Max nuclease achieved superior editing efficiency, has a broad PAM sequence recognition profile, and demonstrated a significant reduction of off-target effects. These achievements make hfCas12Max nuclease particularly well-suited for therapeutic applications, as demonstrated through its effective use in ex vivo T-cell editing and in vivo delivery gene editing showcasing its potential to address genetic disorders and drive CRISPR-based therapies.
Check out the science behind how hfCas12Max nuclease was engineered for therapeutic application.
The publication highlights the development of hfCas12Max nuclease, an engineered high-fidelity variant of the Cas12i system, optimized for therapeutic application. Engineered using a unique platform, hfCas12Max nuclease achieved superior editing efficiency, has a broad PAM sequence recognition profile, and demonstrated a significant reduction of off-target effects. These achievements make hfCas12Max nuclease particularly well-suited for therapeutic applications, as demonstrated through its effective use in ex vivo T-cell editing and in vivo delivery gene editing showcasing its potential to address genetic disorders and drive CRISPR-based therapies.
Challenge: Achieving high editing efficiency without sacrificing viability, especially in difficult-to-edit cell types like primary T cells.
Solution: hfCas12Max nuclease demonstrates high editing efficiency and viability in a range of cells important for therapeutic development, including notoriously difficult cell types, like T cells.
Challenge: Using nuclease with less specific binding affinity for their targets results in higher off-target editing.
Solution: Results of high on-target editing with reduced off-target editing can be achieved with hfCas12Max enabling you to develop safer therapies.
Challenge: Finding a PAM site near your desired edit location can be challenging when traditional nucleases with strict PAM requirements limit your editing options.
Solution: hfCas12Max nuclease has a broad PAM sequence recognition profile giving you the flexibility you need to edit a wider genomic region, including in AT-rich genomes.
HfCas12Max Nuclease (300 pmol)
hfCas12Max nuclease will ship frozen in a cold shipping container with freezer packs.
hfCas12Max is delivered at a concentration of 20 μM in the following storage buffer:
hfCas12Max nuclease should immediately be stored at -20°C upon arrival. At -20°C conditions, hfCas12Max nuclease has a minimum shelf life of 18 months (with minimized freeze/thaw cycles). Avoid unnecessary freeze/thaw cycles to prevent degradation of hfCas12Max nuclease.
When being used, hfCas12Max nuclease should be thawed and stored on ice. Immediately place hfCas12Max nuclease in -20°C conditions when done being used.
It is highly encouraged to work in RNase-free and sterile environments when using hfCas12Max and gRNA. Using sterile filter pipette tips is essential as it decreases the risk of introducing RNases or other contaminants into your samples.
For additional instructions and guidance on using hfCas12Max nuclease and gRNA, please follow our hfCas12Max Quick Start Guide.
Our comprehensive hfCas12Max protocol provides step-by-step guidance to ensure optimal handling, storage, and use of hfCas12Max nuclease and CRISPR gRNA. You can also explore additional resources showcasing how hfCas12Max can be used to develop your CRISPR-based therapeutic.