Learn more Webcast featuring eSpOT-ON
Explore More eSpOT-ON Nuclease Protein Available Now
Explore More Order eSpOT-ON Nuclease mRNA Now
PRODUCT

hfCas12max Recombinant Protein

High-fidelity Cas12 nuclease protein for therapeutic gene editing

hfCas12Max is a high-fidelity CRISPR nuclease engineered for therapeutic genome editing. It offers high on-target and low off-target editing across various cell types. Its small size and broad PAM sequence recognition make it an ideal choice for both ex vivo and in vivo CRISPR-based therapeutic development, allowing you to edit more of the genome with confidence.

  • Engineered for high-fidelity with high on-target and low off-target editing
  • Broad PAM sequence recognition expands the range of editable genomic sites
  • Small size allows for efficient delivery using AAV and lipid nanoparticles
  • Requires a shorter sgRNA, enhancing stability and editing efficiency

Select a Size

hfCas12max Recombinant Protein (300 pmol)

#R20HFCAS12MAX-Sm
Overview

Key Features of hfCas12Max CRISPR Nuclease

  • Engineered CRISPR Nuclease
  • Broad PAM Sequence Recognition While Maintaining High Specificity
  • Commercial sub-license available
  • Small Size
  • High Fidelity (high on-target; low off-target)
  • Excellent CRISPR nuclease for ex vivo and in vivo CRISPR-based Therapies

Product Specifications

Product Number R20HFCAS12MAX
Concentration 2.93 mg/mL
10 mg/mL
Volume 15 µL
50 µL
100 µL
500 µL
Intended Use This product is intended for research use only
Shipping Conditions Cold Pack
Buffer Composition 30mM Tris, 350mM NaCl, 50% Glycerol, 0.1mM EDTA, 1mM DTT, pH 8.0
Source E. coli
Purity ≥ 95%
Delivery Format Tubes
Function Enables high-fidelity gene editing with an expanded targeting range through direct delivery of a ribonucleoprotein (RNP) complex.
For Use In CRISPR gene editing experiments utilizing the hfCas12Max recombinant protein nuclease
Storage Temperature -20 C

About hfCas12Max CRISPR Nuclease

Navigating the SpCas9 intellectual property landscape for cell and gene therapies can be complex and may lead to development delays. To overcome these challenges, researchers are turning to alternative nucleases with therapeutic potential. These alternative nucleases offer efficient editing across diverse cell populations and can effectively target specific genomic regions, supporting the advancement of innovative therapies. Enter hfCas12Max nuclease, an engineered Cas12i nuclease.

As a nuclease already in clinical trials treating Duchenne muscular dystrophy, hfCas12Max nuclease has demonstrated to be great for developing cell and gene therapies due to its high fidelity, broad PAM recognition profile, and small size. Across various cell types, including primary T cells and iPSCs, hfCas12Max nuclease consistently has high performance, resulting in high on-target and minimal off-target editing, referred to as high-fidelity. Due to its high-fidelity, hfCas12Max nuclease is also a safer nuclease candidate to use in therapies compared to nucleases that result in low on-target and high-off-target editing. To enable scientists to access a wider genomic region to target for the development of novel and innovative therapies, hfCas12Max nuclease broad PAM sequence recognition profile expands where gene editing can occur with continued high-fidelity. Lastly, delivering hfCas12Max nuclease in lipid nanoparticles (LNPs) or adeno-associated viruses (AAVs) for in vivo CRISPR-based therapies is easier because of its smaller size (1080 amino acids) compared to SpCas9 nuclease (1368 amino acids) and LbCas12a nuclease (1228 amino acids).

Are you looking to commercialize your ex vivo or in vivo therapeutic using hfCas12Max nuclease? With lower upfront costs and clear milestones, licensing hfCas12Max simplifies your path to commercialization. Contact our team today to learn how you can secure your hfCas12Max license and take the next step toward developing your therapy to help those who need it.

Design hfCas12Max gRNA and Analysis of hfCas12Max Edits

Try hfCas12Max nuclease and gRNA in your workflow with our validated* gRNAs below.
Gene Name hfCas12Max Target Sequence
B2M TATCTCTTGTACTACACTGA
TRAC GAGTCTCTCAGCTGGTACAC
*Validated in human cell lines (HEK293T, T Cells, and iPSC). hfCas12Max gRNAs are not compatible with SpCas9. SpCas9 sgRNA controls can be purchased here.

For CRISPR gene editing, hfCas12Max nuclease is unique in that it can complex with crRNA without the need for a tracrRNA. This means hfCas12Max gRNA length is small, ranging from 44-50 nucleotides (nt) in length, where the target genomic sequence is 17-23 nt long. When complexed with our best-in-class Research gRNA, hfCas12Max nuclease single RuVC domain will nick the non-target strand and cut the targeted strand in a staggered manner; cleavage predicted 14-16 nt and 24 nt downstream of the PAM site for non-targeted and targeted strand, respectively.

To design hfCas12Max gRNA, upload the 5'-TN-3' or 5'-TTN-3' PAM sequence into your favorite guide design platform (e.g., CHOPCHOP, Benchling, CRISPOR, or CRISPR RGEN Tools). Once your hfCas12Max gRNA is designed, we will synthesize them quickly so you can start using hfCas12Max in your work immediately. Currently, you can order hfCas12Max gRNA with modifications because the modifications enhance gene editing efficiency. The following modifications are included on our hfCas12Max modified gRNA:

2'-O-Methyl analog at the first 3 bases. The last 4 bases have 3 modifications ending with a nonmodified base. With 3' phosphorothioate bonds between 3 first and last 4 bases.

We strongly encourage you to follow our user guide to review important information before using hfCas12Max nuclease and gRNA. We also developed transfection protocols specifically designed for our gRNA and nucleases to help you get started with your experiments. Following any CRISPR experiment, it is best practice to analyze your CRISPR edits. One way you can analyze your hfCas12Max CRISPR edits is by using platforms like the Inference of CRISPR Edits analysis tool, or ICE for short.

CRISPR Nuclease Comparison of SpCas9 vs hfCas12Max

Image
RNP complex schematics of SpCas9 (left) and hfCas12Max (right). Depicted in the schematic are genomic DNA (light blue), PAM sequence (pink), and predicted cut site locations on genomic DNA (gray scissors). Nucleases are depicted in light green/blue gradient color. The guide RNA or gRNA is comprised of the target sequence (green) and scaffold (dark blue).

SpCas9 vs hfCas12Max

SpCas9 Nuclease

hfCas12Max Nuclease

Description The nuclease that led to Jennifer Doudna and Emmanuelle Charpentier's Nobel Prize. Engineered from Cas12i to achieve higher on-target editing and minimized off-target editing.
Size 1368 amino acids 1080 amino acids
PAM Sequence (N = any nucleotide) 5'-NGG-3'

PAM is 3’ of the target DNA sequence
5'-TN-3' or 5'-TTN-3
DNA Cleavage Blunt end cut 3nt upstream of PAM sequence. Staggered-cut: cleavage on the target strand occurs 24nt downstream from PAM, while the non-targeted strand is cut 14-16nt downstream.
Endonuclease Domains HNH and RuvC RuvC
gRNA Length and Target Sequence 97 - 103nt

20nt Target Sequence
44 - 50nt

20nt Target Sequence
gRNA Components crRNA + tracrRNA as a single guide RNA (sgRNA) crRNA
Variants or Origin Streptococcus pyogenes (Wildtype) Engineered from Cas12i
CRISPR Enzyme Class Type IIa CRISPR-Cas system of Streptococcus pyogenes Cas9 Type V CRISPR-Cas system of Cas12
Application A wide range of applications spanning from research use to cell & gene therapy development for clinical trials.

As you develop your CRISPR-based therapeutic using hfCas12Max nuclease, you will need to navigate the regulatory landscape to successfully reach the clinic. Although a daunting task, our Regulatory Experts can help guide you through the regulatory process.

To learn about the regulatory process, download our Regulatory eBook — a comprehensive guide to navigating the regulatory framework for CRISPR clinical trials.

Check out the science behind how hfCas12Max nuclease was engineered for therapeutic application.

The publication highlights the development of hfCas12Max nuclease, an engineered high-fidelity variant of the Cas12i system, optimized for therapeutic application. Engineered using a unique platform, hfCas12Max nuclease achieved superior editing efficiency, has a broad PAM sequence recognition profile, and demonstrated a significant reduction of off-target effects. These achievements make hfCas12Max nuclease particularly well-suited for therapeutic applications, as demonstrated through its effective use in ex vivo T-cell editing and in vivo delivery gene editing showcasing its potential to address genetic disorders and drive CRISPR-based therapies.

Check out the science behind how hfCas12Max nuclease was engineered for therapeutic application.

The publication highlights the development of hfCas12Max nuclease, an engineered high-fidelity variant of the Cas12i system, optimized for therapeutic application. Engineered using a unique platform, hfCas12Max nuclease achieved superior editing efficiency, has a broad PAM sequence recognition profile, and demonstrated a significant reduction of off-target effects. These achievements make hfCas12Max nuclease particularly well-suited for therapeutic applications, as demonstrated through its effective use in ex vivo T-cell editing and in vivo delivery gene editing showcasing its potential to address genetic disorders and drive CRISPR-based therapies.

Nuclease That Can Perform Gene Editing Across A Wide Range Of Cell Types

Challenge: Achieving high editing efficiency without sacrificing viability, especially in difficult-to-edit cell types like primary T cells.

Solution: hfCas12Max nuclease demonstrates high editing efficiency and viability in a range of cells important for therapeutic development, including notoriously difficult cell types, like T cells.

Image
Examining hfCas12Max’s nuclease editing efficiency across multiple cell types, specifically targeting the TRAC gene. The results demonstrated that hfCas12Max achieved an average editing efficiency of 60% across various cell types.

High Cell Viability Is Valuable To Perform Downstream Assays

Image
Knockout of TRAC in primary T cells was done using hfCas12Max nuclease. Analysis of editing efficiency was analyzed by Sanger sequencing.

hfCas12Max Successfully Knocks Out Multiple Genes

Image
Using hfCas12Max Nuclease, a single knockout of TRAC (A) and a double knockout of B2M and TRAC (B) was achieved in primary T cells. Editing efficiency was evaluated using Sanger sequencing, while TRAC protein expression was analyzed through flow cytometry.

Lower Off-Target Editing For Safer Therapies

Challenge: Using nuclease with less specific binding affinity for their targets results in higher off-target editing.

Solution: Results of high on-target editing with reduced off-target editing can be achieved with hfCas12Max enabling you to develop safer therapies.

Image
On-target (ON) and off-target (OF) analysis comparison of hfCas12Max, UltraAsCas12a, and LbCas12a targeting P2RX5 loci (A) and CLIC4 loci (B). NGS verification of in silico off-target sites. hfCas12Max demonstrates minimal off targets when compared to other Cas12 nucleases.
Image
Off-target analysis comparison between hfCas12Max (A) and SpCas9 (B).Verified via NGS with additional analysis conducted in silico and with PEM-seq off-target analysis.

Unlock Gene Editing at More Genomic Targets With Ease

Challenge: Finding a PAM site near your desired edit location can be challenging when traditional nucleases with strict PAM requirements limit your editing options.

Solution: hfCas12Max nuclease has a broad PAM sequence recognition profile giving you the flexibility you need to edit a wider genomic region, including in AT-rich genomes.

Image
Comparative analysis of PAM sequence recognition between hfCas12Max nuclease and other common Cas nucleases reveals that hfCas12Max nuclease exhibits an expanded PAM recognition profile.

What To Expect When Ordering hfCas12Max Nuclease

Offerings:

  • HfCas12Max Nuclease (300 pmol)

Shipping conditions:

hfCas12Max nuclease will ship frozen in a cold shipping container with freezer packs.

hfCas12Max is delivered at a concentration of 20 μM in the following storage buffer:

  • 30mM Tris, 350mM NaCl, 50% Glycerol, 0.1mM EDTA, 1mM DTT, pH 8.0

Storage conditions:

hfCas12Max nuclease should immediately be stored at -20°C upon arrival. At -20°C conditions, hfCas12Max nuclease has a minimum shelf life of 18 months (with minimized freeze/thaw cycles). Avoid unnecessary freeze/thaw cycles to prevent degradation of hfCas12Max nuclease.

When being used, hfCas12Max nuclease should be thawed and stored on ice. Immediately place hfCas12Max nuclease in -20°C conditions when done being used.

Handling recommendations:

It is highly encouraged to work in RNase-free and sterile environments when using hfCas12Max and gRNA. Using sterile filter pipette tips is essential as it decreases the risk of introducing RNases or other contaminants into your samples.

Use recommendations:

For additional instructions and guidance on using hfCas12Max nuclease and gRNA, please follow our hfCas12Max Quick Start Guide.

Explore hfCas12Max Protocols and Other Resources

Our comprehensive hfCas12Max protocol provides step-by-step guidance to ensure optimal handling, storage, and use of hfCas12Max nuclease and CRISPR gRNA. You can also explore additional resources showcasing how hfCas12Max can be used to develop your CRISPR-based therapeutic.

Ready to get started?

Get in touch